What is the difference between forward primer and reverse primer?

The main difference between forward and reverse primers is that forward primers anneal to the antisense strand of the double-stranded DNA, which runs from 3′ to 5′ direction, whereas reverse primers anneal to the sense strand of the double-stranded DNA, which runs from 5′ to 3′ direction.

How do you know if primer is forward or reverse?

The forward primer is easy and is the primer that resides on the bottom strand on the 3′ side. The reverse primer is more complicated and binds to the top strand on the 3′ side.

Why are two types of primer needed in PCR?

Two primers are used in each PCR reaction, and they are designed so that they flank the target region (region that should be copied). That is, they are given sequences that will make them bind to opposite strands of the template DNA, just at the edges of the region to be copied.

Why is it called a forward primer?

The primer that anneals with the antisense strand or the noncoding strand or the template strand is known as forward primer since forward primer acts as a starting point to the synthesis of coding or the positive strand of the gene.

Do forward and reverse primers have to be the same length?

It’s not necessary for primers forward and reverse have the same lenght. Tm value of both the primers should be +/- 2, will work perfectly with your PCR.

Which primer is most suitable for PCR?

Primers for PCR and sequencing should have a GC content between 40\% and 60\%. The GC content (the number of G’s and C’s in the primer as a percentage of the total bases) of primer should be 40-60\%. Start and end with 1-2 G/C pairs.

Is left primer forward or reverse?

The forward primer’s sequence (‘Left Primer’) is identical with the sequence of the reference strand, and binds therefore on the complement strand (TAACTCCACCATTAGCACCC shown positioned below complement strand).